NEET 2023 Biology Question Paper with Answer and Solution

(B) The life cycle of a moss consists of a dominant gametophyte phase which includes two stages.
The first stage is the protonema stage,which develops directly from a haploid spore.
These spores are produced within the capsule of the sporophyte generation.
Since the protonema is the direct product of spore germination,the Reason $R$ correctly explains the Assertion $A$.

(D) Option $D$ is the correct answer.
Cellulose is a linear polysaccharide consisting of a long chain of glucose units linked by $\beta-1, 4$-glycosidic bonds.
Unlike starch,which contains amylose (a helical structure that traps iodine molecules to produce a blue color),cellulose does not form complex helical structures.
Because it lacks these complex helices,it cannot hold iodine molecules,and therefore,it does not produce a blue color with iodine.

(B) Manganese $(Mn^{2+})$ plays a critical role in the photolysis of water,which is the splitting of water molecules to release oxygen,electrons,and protons during the light-dependent reactions of photosynthesis.
Copper $(Cu)$ is essential for electron transport in the chloroplasts and overall plant metabolism.
Molybdenum $(Mo)$ is primarily involved in nitrogen metabolism,specifically in the enzyme nitrogenase and nitrate reductase.
Magnesium $(Mg)$ is a structural component of the chlorophyll molecule and acts as an activator for several enzymes involved in photosynthesis and respiration.

(B) $ATP$ is consumed in glycolysis at two specific phosphorylation steps:
$1$. Conversion of Glucose to Glucose-$6$-phosphate (catalyzed by hexokinase).
$2$. Conversion of Fructose-$6$-phosphate to Fructose-$1,6$-bisphosphate (catalyzed by phosphofructokinase).
Since both statements correctly describe the process of phosphorylation in glycolysis,Assertion $A$ is true,and Reason $R$ provides the correct explanation for why $ATP$ is used.

(D) The splitting of the centromere occurs during the anaphase of mitosis or anaphase $II$ of meiosis.
During Metaphase $I$ and $II$,chromosomes align at the equatorial plate.
During telophase,chromosomes reach their respective poles and decondense.

(D) Ethylene is a gaseous plant hormone that plays a crucial role in the growth and development of plants.
In deep water rice plants,ethylene promotes rapid internode and petiole elongation.
This adaptation allows the leaves and upper parts of the plant to remain above the water surface,ensuring continued gas exchange and survival during flooding conditions.

(C) For every $CO_2$ molecule entering the Calvin cycle,$3$ molecules of $ATP$ and $2$ molecules of $NADPH_2$ are required.
To synthesize one molecule of glucose $(C_6H_{12}O_6)$,$6$ turns of the Calvin cycle are necessary because each turn fixes one carbon atom.
Therefore,the total requirement is calculated as:
$6 \times (3\,ATP + 2\,NADPH_2) = 18\,ATP$ and $12\,NADPH_2$.

(B) In family $Fabaceae$,the stamens are $Diadelphous$ (arranged in two bundles) and the anthers are $Dithecous$ (two-lobed).
In family $Solanaceae$,the stamens are $Polyandrous$ (free),$Epipetalous$ (attached to petals),and $Dithecous$.
In family $Liliaceae$,the stamens are $Polyandrous$,$Epiphyllous$ (attached to tepals),and $Dithecous$.
Therefore,the characteristic specific to $Fabaceae$ is $Diadelphous$ condition.

(C) The process of recombination occurs at the Pachytene stage of prophase $I$.
This stage is characterized by the appearance of recombination nodules,which are sites at which crossing over occurs between non-sister chromatids of homologous chromosomes.

(B) In $PS-I$,the reaction centre chlorophyll $a$ has an absorption peak at $700\,nm$.
In $PS-II$,the reaction centre chlorophyll $a$ has an absorption maxima at $680\,nm$.

(C) Spraying juvenile conifers with $Gibberellic Acid$ $(GA)$ hastens the maturity period of the plants.
This physiological effect leads to early seed production in these conifers.
Therefore, $Gibberellic Acid$ is used in forestry to shorten the breeding cycle.

(C) In tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This phenomenon is called $Dedifferentiation$.
$Dedifferentiation$ is a biological phenomenon by which living differentiated plant cells, which have lost the capacity to divide, regain the capacity of division under certain experimental conditions.

(B) Statement $I$ is correct. Measurements reveal that the transpiration pull generated in the leaves can create pressures sufficient to lift a xylem-sized column of water up to $130 \text{ meters}$ high.
Statement $II$ is also correct. Transpiration provides a cooling effect on leaf surfaces,often reducing the temperature by $10$ to $15$ degrees Celsius through the process of evaporative cooling.

(A) The movement and accumulation of ions across a membrane against their concentration gradient is defined as active transport.
Active transport requires metabolic energy (usually in the form of $ATP$) to move molecules from a region of lower concentration to a region of higher concentration.
Unlike passive transport,which moves substances along the concentration gradient without energy expenditure,active transport is an energy-dependent process.

(A) In axile placentation,the placenta is axial and the ovules are attached to it in a multilocular ovary.
Examples of plants exhibiting axile placentation include China rose,Tomato,Petunia,and Lemon.
Dianthus and Primrose exhibit free central placentation,where ovules are borne on a central axis without septa.
Pea,Lupin,and Beans exhibit marginal placentation,where the placenta forms a ridge along the ventral suture of the ovary.
Cucumber and Mustard exhibit parietal placentation,where the ovules develop on the inner wall of the ovary or on peripheral parts.

(C) In eukaryotes,the replication of $DNA$ occurs during the $S$ phase (Synthesis phase) of the cell cycle.
During this phase,the amount of $DNA$ per cell doubles,although the chromosome number remains the same.
In contrast,the $G_1$ phase involves cell growth and the duplication of most cell organelles,while the $G_2$ phase involves protein synthesis and preparation for mitosis.

(A) Endarch and exarch are terms used to describe the arrangement of primary xylem,not secondary xylem.
Primary xylem consists of protoxylem and metaxylem. Based on the relative position of protoxylem and metaxylem within an organ,the arrangement is classified as either endarch or exarch.
In the endarch condition,protoxylem lies towards the center (pith),which is characteristic of stems. In the exarch condition,protoxylem lies towards the periphery,which is a characteristic feature of roots.
Therefore,Statement $I$ is false because it mentions secondary xylem instead of primary xylem,and Statement $II$ is true.

(C) Pteridophytes that produce two different kinds of spores,known as microspores and megaspores,are called heterosporous.
$Selaginella$ and $Salvinia$ are well-known examples of heterosporous pteridophytes.
In contrast,$Psilotum$,$Lycopodium$,and $Equisetum$ are homosporous,meaning they produce only one type of spore.

(B) During the winter season,the activity of the vascular cambium is reduced due to environmental conditions.
Because the cambium is less active,it produces fewer xylary elements that possess narrow vessels.
This type of wood formed during the winter is known as autumn wood or late wood.
Therefore,both Assertion $A$ and Reason $R$ are true,and Reason $R$ correctly explains Assertion $A$.

(C) Statement $A$ is correct: Lenticels are lens-shaped openings that allow the exchange of gases between the external atmosphere and the internal tissues of the stem.
Statement $B$ is incorrect: Bark formed early in the season is called early or soft bark,while bark formed towards the end of the season is called late or hard bark.
Statement $C$ is incorrect: Bark is a non-technical term that refers to all tissues exterior to the vascular cambium.
Statement $D$ is correct: Bark refers to a number of tissue types,including periderm and secondary phloem.
Statement $E$ is incorrect: Phellogen (cork cambium) is generally a couple of layers thick.
Therefore,statements $A$ and $D$ are correct.

(C) $M$ phase (Mitosis) is the phase where actual cell division occurs, often called equational division $(A-IV)$.
During $G_2$ phase, the cell synthesizes proteins and $RNA$ required for mitosis $(B-I)$.
Quiescent stage $(G_0)$ is the inactive phase where cells that do not divide further enter $(C-II)$.
$G_1$ phase is the interval between mitosis and the initiation of $DNA$ replication $(D-III)$.
Therefore, the correct matching is $A-IV, B-I, C-II, D-III$.

(D) Assertion $A$ is true because in gymnosperms,pollination is anemophilous (wind-pollinated),and pollen grains are released from the microsporangium to be carried by air currents.
Reason $R$ is false because,in gymnosperms,a pollen tube is indeed formed. The pollen grains reach the opening of the ovules,where they germinate to form a pollen tube that grows towards the archegonia to discharge the male gametes.

(D) Iron $(Fe)$ acts as an activator for the enzyme catalase.
Zinc $(Zn)$ is essential for the synthesis of the plant hormone auxin.
Boron $(B)$ plays a crucial role in cell elongation and cell differentiation.
Molybdenum $(Mo)$ is a vital component of enzymes like nitrogenase and nitrate reductase.
Matching these: $A-III, B-I, C-IV, D-II$.
Therefore, the correct option is $D$.

(B) Chemiosmosis is the movement of ions across a semi-permeable membrane down their electrochemical gradient.
In photosynthesis,it specifically requires:
$1$. $A$ membrane (e.g.,the thylakoid membrane).
$2$. $A$ proton pump (to create a proton gradient).
$3$. $A$ proton gradient (accumulation of $H^+$ ions in the lumen).
$4$. $ATP$ synthase (the enzyme that uses the energy of the proton gradient to synthesize $ATP$ from $ADP$ and inorganic phosphate).

(B) The ribosome is a complex cellular structure composed of ribosomal $RNA$ $(rRNA)$ and various proteins. In eukaryotic cells,the ribosome consists of structural RNAs and approximately $80$ different proteins that work together to facilitate the process of protein synthesis (translation).

(B) The correct matches are as follows:
$A$. Cohesion: Mutual attraction among water molecules $(II)$.
$B$. Adhesion: Attraction of water molecules to polar surfaces $(IV)$.
$C$. Surface tension: Water molecules are attracted to each other in the liquid phase more than to water in the gas phase $(I)$.
$D$. Guttation: Loss of water in liquid phase $(III)$.
Therefore, the correct sequence is $A-II, B-IV, C-I, D-III$, which corresponds to option $B$.

(A) $1$. Oxidative decarboxylation: Pyruvate, formed by glycolysis in the cytosol, enters the mitochondrial matrix and undergoes oxidative decarboxylation catalyzed by the enzyme complex pyruvate dehydrogenase $(A-II)$.
$2$. Glycolysis: The scheme of glycolysis was proposed by Gustav Embden, Otto Meyerhof, and $J$. Parnas, and is commonly known as the $EMP$ pathway $(B-IV)$.
$3$. Oxidative phosphorylation: In the electron transport system, the energy from oxidation-reduction reactions is used to create a proton gradient, which drives the phosphorylation of $ADP$ to $ATP$ $(C-III)$.
$4$. Tricarboxylic acid cycle $(TCA)$: The $TCA$ cycle begins with the condensation of an acetyl group with oxaloacetic acid $(OAA)$ and water to form citric acid, a reaction catalyzed by citrate synthase $(D-I)$.
Therefore, the correct matching is $A-II, B-IV, C-III, D-I$.

(B) Option $B$ is the correct answer because malonate is a competitive inhibitor of the enzyme succinate dehydrogenase.
Inhibition of succinate dehydrogenase by malonate occurs due to the close structural resemblance between malonate and the substrate succinate.
Competitive inhibitors are often used in the control of bacterial pathogens.

(C) Statement $I$ is incorrect because ligaments are composed of dense regular connective tissue,not dense irregular tissue.
Statement $II$ is incorrect because cartilage is a type of specialised connective tissue,not dense regular tissue.
Therefore,both Statement $I$ and Statement $II$ are false.

(C) The correct matching is as follows:
$A$. Cartilaginous Joint: These joints are found between adjacent vertebrae in the vertebral column $(A-II)$.
$B$. Ball and Socket Joint: This joint is found between the humerus and the pectoral girdle,allowing for rotational movement $(B-IV)$.
$C$. Fibrous Joint: These joints do not allow any movement and are found between the flat skull bones,which fuse end-to-end with the help of dense fibrous connective tissues $(C-I)$.
$D$. Saddle Joint: This joint is found between the carpal and metacarpal of the thumb,allowing for greater range of motion $(D-III)$.
Therefore,the correct sequence is $A-II, B-IV, C-I, D-III$.

(B) The correct matching is as follows:
- $CCK$ (Cholecystokinin) acts on the pancreas to stimulate the secretion of pancreatic enzymes. Thus, $A-IV$.
- $GIP$ (Gastric Inhibitory Peptide) acts on the gastric glands to inhibit gastric secretion and motility. Thus, $B-III$.
- $ANF$ (Atrial Natriuretic Factor) is released from the atrial wall of the heart. Thus, $C-II$.
- $ADH$ (Anti-diuretic hormone) acts mainly on the kidney to stimulate the reabsorption of water and electrolytes. Thus, $D-I$.
Therefore, the correct sequence is $A-IV, B-III, C-II, D-I$, which corresponds to option $B$.

(A) The endomembrane system includes the endoplasmic reticulum $(ER)$, Golgi complex, lysosomes, and vacuoles.
Since the functions of the mitochondria, chloroplasts, and peroxisomes are not coordinated with the above-mentioned components, they are not considered part of the endomembrane system.
Therefore, the organelles that are $NOT$ part of the endomembrane system are mitochondria $(A)$, chloroplasts $(C)$, and peroxisomes $(E)$.

(D) The correct matching is as follows:
$A$. $Taenia$ (Platyhelminthes) uses flame cells $(III)$ for excretion.
$B$. $Paramoecium$ uses contractile vacuoles $(II)$ for osmoregulation and excretion.
$C$. $Periplaneta$ (Cockroach) uses urecose glands $(IV)$ for excretion.
$D$. $Pheretima$ (Earthworm) uses nephridia $(I)$ for excretion.
Therefore, the correct sequence is $A-III, B-II, C-IV, D-I$.

(C) Option $C$ is the correct answer because the undigested and unabsorbed substances (faeces) enter the caecum of the large intestine from the ileum through the ileo-caecal valve.
The primary function of the ileo-caecal valve is to prevent the backflow of faecal matter from the caecum into the ileum.
Option $A$ is incorrect because the pyloric sphincter regulates the opening between the stomach and the duodenum.
Option $B$ is incorrect because the sphincter of Oddi guards the opening of the common hepato-pancreatic duct into the duodenum.
Option $D$ is incorrect because the gastro-oesophageal sphincter regulates the opening of the oesophagus into the stomach.

(B) The correct answer is $A-III, B-I, C-IV, D-II$.
$1$. Fovea $(A-III)$: It is the central pit in the macula lutea, which is the point of greatest visual acuity or resolution.
$2$. Iris $(B-I)$: It is the visible coloured portion of the eye that regulates the diameter of the pupil.
$3$. Blind spot $(C-IV)$: It is the point on the retina where the optic nerve leaves the eyeball; photoreceptor cells are absent here, resulting in no vision.
$4$. Sclera $(D-II)$: It is the external layer of the eye formed of dense connective tissue, providing structural support.

(B) Statement $I$ is true: Enzymes are proteins. At low temperatures,enzymes remain in an inactive state but are not destroyed; they can regain activity when the temperature increases. At high temperatures,the hydrogen bonds and other stabilizing forces in the protein structure break,leading to denaturation and permanent loss of enzymatic activity.
Statement $II$ is true: $A$ competitive inhibitor has a molecular structure similar to the substrate. Because of this structural similarity,it competes with the substrate for the active site of the enzyme,thereby inhibiting the reaction.
Therefore,both statements are correct.

(C) The correct answer is $C$ (Hemichordata).
$1$. $Hemichordata$ are bilaterally symmetrical animals.
$2$. $Echinodermata$ adults exhibit radial symmetry (specifically pentamerous radial symmetry),although their larvae are bilaterally symmetrical.
$3$. $Ctenophora$ exhibit radial symmetry.
$4$. $Coelenterata$ (Cnidaria) exhibit radial symmetry.
Therefore,radial symmetry is not found in the adults of $Hemichordata$.

(D) The correct matching is as follows:
$A$. Peptic cells (Chief cells) secrete the proenzyme pepsinogen $(III)$.
$B$. Goblet cells secrete mucus $(I)$.
$C$. Oxyntic cells (Parietal cells) secrete $HCl$ and intrinsic factor for the absorption of vitamin $B_{12}$ $(IV)$.
$D$. Hepatic cells (Liver cells) secrete bile juice $(II)$.
Therefore,the correct sequence is $A-III, B-I, C-IV, D-II$.

(A) The correct answer is $A$.
Vital capacity $(VC)$ is defined as the maximum volume of air a person can breathe in after a forced expiration.
It includes the Inspiratory Reserve Volume $(IRV)$,Tidal Volume $(TV)$,and Expiratory Reserve Volume $(ERV)$.
Mathematically,$VC = IRV + TV + ERV$.

(A) Statement $I$ is false because,by convention,a protein is represented as a line where the left end is the first amino acid ($N$-terminal) and the right end is the last amino acid ($C$-terminal). The statement incorrectly swapped these terminals.
Statement $II$ is true because adult human haemoglobin is a quaternary structure composed of $4$ polypeptide subunits: two $\alpha$-subunits and two $\beta$-subunits.
Therefore,Statement $I$ is false and Statement $II$ is true.

(D) The Assertion $A$ is true because nephrons are classified into two types,cortical and juxtamedullary,based on their relative position in the cortex and medulla.
The Reason $R$ is false because juxtamedullary nephrons have a very long loop of Henle that extends deep into the medulla,which helps in concentrating the urine.
Conversely,cortical nephrons have a very short loop of Henle that extends only slightly into the medulla.
Therefore,the correct answer is that $A$ is true but $R$ is false.

(D) An elaborate network of filamentous proteinaceous structures consisting of microtubules,microfilaments,and intermediate filaments present in the cytoplasm is collectively referred to as the cytoskeleton.
It is involved in many functions such as mechanical support,motility,and maintenance of the shape of the cell.

(B) In a standard $ECG$:
- The $P$-wave represents the electrical excitation (or depolarisation) of the atria,which leads to the contraction of both atria $(A-III)$.
- The $Q$-wave marks the beginning of ventricular systole $(B-I)$.
- The $QRS$ complex represents the depolarisation of the ventricles,which initiates ventricular contraction $(C-IV)$.
- The $T$-wave represents the return of the ventricles from an excited to a normal state (repolarisation) $(D-II)$.
Therefore,the correct matching is $A-III, B-I, C-IV, D-II$.

(B) Option $B$ is the correct answer because the limbic system,along with the hypothalamus,regulates sexual behaviour,the expression of excitement,pleasure,rage,fear,etc.
Option $A$,$C$,and $D$ are incorrect because:
$1$. Corpora quadrigemina is a part of the midbrain consisting of four round swellings.
$2$. Corpus callosum is a tract of nerve fibres that connects the right and left cerebral hemispheres.
$3$. Thalamus is a major coordinating centre in the forebrain for sensory and motor signalling.
$4$. The midbrain,pons,and medulla oblongata together form the brain stem.

(C) Statement $A$ is incorrect because an excessive loss of body fluid switches $ON$ the osmoreceptors,not $OFF$.
Statement $B$ is correct because $ADH$ (Antidiuretic Hormone) facilitates water reabsorption from the distal parts of the tubule,thereby preventing diuresis.
Statement $C$ is correct because $ANF$ (Atrial Natriuretic Factor) is released by the atrial wall of the heart in response to increased blood flow and causes vasodilation (dilation of blood vessels) to decrease blood pressure.
Statement $D$ is correct because $ADH$ increases water reabsorption,which increases blood volume and consequently increases blood pressure.
Statement $E$ is incorrect because $ADH$ does not cause a decrease in $GFR$ (Glomerular Filtration Rate); rather,it helps in maintaining water balance.
Therefore,statements $B, C$ and $D$ are correct.

(C) The fundamental characteristics of chordates include:
$1$. Presence of a notochord.
$2$. Presence of a dorsal,hollow,and single nerve cord.
$3$. Presence of paired pharyngeal gill slits.
$4$. Presence of a post-anal tail.
$5$. Presence of a ventral heart.
$6$. Presence of a closed circulatory system.
Evaluating the given statements:
$A$. Incorrect: Chordates have a dorsal,hollow,and single nerve cord,not solid and double.
$B$. Correct: Chordates possess a closed circulatory system.
$C$. Correct: Chordates possess paired pharyngeal gill slits at some stage of their life cycle.
$D$. Incorrect: Chordates have a ventral heart,not a dorsal heart.
$E$. Incorrect: Chordates are triploblastic and coelomate,not pseudocoelomate.
Therefore,only statements $B$ and $C$ are correct.

(C) Option $C$ is the correct answer because anal styles are present only in male cockroaches and are absent in female cockroaches.
Options $A$,$B$,and $D$ are incorrect because anal cerci,dark brown body colour,and sclerites are common features found in both male and female cockroaches.

(A) Statement $I$ is incorrect because cells in the $G_0$ phase (quiescent stage) remain metabolically active,although they do not proliferate unless required by the organism.
Statement $II$ is correct because,in animal cells,$DNA$ replication occurs in the nucleus and centrosome duplication occurs in the cytoplasm during the $S$ phase of interphase.
Therefore,Statement $I$ is incorrect and Statement $II$ is correct.

(D) Thyroid hormones play a crucial role in the regulation of the basal metabolic rate $(BMR)$.
They are also involved in the maintenance of water and electrolyte balance.
Furthermore,they support the process of red blood cell $(RBC)$ formation (erythropoiesis).
However,the normal rhythm of the sleep-wake cycle is primarily regulated by melatonin (secreted by the pineal gland),and the development of the immune system is not a primary function of thyroid hormones.
Therefore,$C$ and $D$ are not under the control of thyroid hormones.

(C) The correct answer is $C$ because the presence of hairs,pinna,and mammary glands are unique features of mammals.
$A$ is incorrect because mammals have a dicondylic skull,whereas a monocondylic skull is found in reptiles and aves.
$B$ is incorrect because the tympanic membrane is also present in amphibians,so it is not a unique feature of mammals.
$D$ is incorrect because mammals exhibit direct development,not indirect development.

(B) Expressed Sequence Tags $(ESTs)$ are a strategy used in the Human Genome Project to identify all the genes that are expressed as $RNA$.
These tags represent short sequences of $cDNA$ generated from $mRNA$ transcripts,which serve as markers for identifying expressed genes in a genome.

(B) The thickness of the ozone layer in a column of air from the ground to the top of the atmosphere is measured in terms of Dobson units $(DU)$.
One Dobson unit is the thickness of $0.01 \ mm$ of ozone at standard temperature and pressure $(STP)$.
Decibels $(dB)$ are used to measure the intensity of sound,not the thickness of ozone.

(A) Option $A$ is the correct answer. In recombinant $DNA$ technology,the separated $DNA$ fragments can be visualized only after staining the $DNA$ with a substance known as ethidium bromide followed by exposure to $UV$ radiation.
When the gel is exposed to $UV$ light,the ethidium bromide-stained $DNA$ fragments appear as bright orange-coloured bands.

(B) The 'Evil Quartet' refers to the four major causes of biodiversity loss: habitat loss and fragmentation,over-exploitation,alien species invasions,and co-extinctions.
Among these,habitat loss and fragmentation is considered the most important cause driving animals and plants to extinction,as it directly destroys the living environment required for survival.

(D) Alfred Sturtevant used the frequency of recombination between gene pairs on the same chromosome as a measure of the distance between genes and 'mapped' their position on the chromosome.
Sutton and Boveri proposed the chromosomal theory of inheritance.
Henking discovered the $X$-chromosome.
Thomas Hunt Morgan proved the chromosomal theory of inheritance and proposed the concept of linkage.

(C) In eukaryotes,there are three major types of $RNA$ polymerases involved in transcription:
$RNA$ polymerase $I$ transcribes $rRNAs$ ($5.8S, 18S,$ and $28S$).
$RNA$ polymerase $II$ transcribes $hnRNA$ (precursor of $mRNA$).
$RNA$ polymerase $III$ transcribes $tRNAs$,$5S$ $rRNA$,and $snRNA$ (small nuclear $RNA$).

(D) considerable amount of $GPP$ is utilized by plants for respiration. Gross primary productivity minus respiration losses $(R)$ is the net primary productivity $(NPP)$.
Therefore,$R$ represents Respiratory loss.

(C) The unequivocal proof that $DNA$ is the genetic material came from the experiment conducted by Alfred Hershey and Martha Chase in $1952$ using bacteriophages.
Frederick Griffith conducted the transformation experiments using $Streptococcus \text{ } pneumoniae$ (Pneumococcus).
Avery,Macleod,and McCarty provided the biochemical characterization of the 'Transforming Principle' identified by Griffith.
Wilkins and Franklin produced the $X$-ray diffraction data of $DNA$ structure.

(C) In a corn cob,the tassels represent the elongated stigma and style of the female flowers. These thread-like structures hang out of the cob and wave in the wind to trap pollen grains,which are carried by the wind for pollination.

(C) During the isolation of genetic material,the final step involves the addition of chilled ethanol to the purified mixture.
This process causes the $DNA$ to precipitate out as fine threads in the suspension.
Therefore,option $(C)$ is the correct answer.
Proteins are removed using proteases,and $RNA$ is removed using ribonuclease enzymes.

(D) Synergids are cells of the female gametophyte and are therefore haploid $(n)$.
Zygote is formed by the fusion of a male gamete $(n)$ and an egg cell $(n)$,making it diploid $(2n)$.
Primary endosperm nucleus $(PEN)$ is formed by the fusion of a diploid secondary nucleus $(2n)$ with a male gamete $(n)$,making it triploid $(3n)$.
Thus,the sequence of haploid,diploid,and triploid structures is Synergids,Zygote,and Primary endosperm nucleus.

(B) Large,colourful,and fragrant flowers that produce nectar are specific adaptations to attract biotic pollinators,particularly insects. These features ensure that insects visit the flowers to collect nectar,thereby facilitating pollination. Therefore,such flowers are characteristic of insect-pollinated plants.

(C) The historic Convention on Biological Diversity,known as 'The Earth Summit',was held in Rio de Janeiro in the year $1992$.
This summit called upon all nations to take appropriate measures for the conservation of biodiversity and the sustainable utilisation of its benefits.

(D) Option $D$ is the correct answer because in the gene gun method (biolistics),microparticles of tungsten or gold are used to bombard host cells.
These metals are chosen because they are chemically inert,meaning they do not react with the cellular components or alter the chemical composition of the host cells.

(A) Statement $A$ is correct: Detritivores (like earthworms) break down detritus into smaller particles,a process known as fragmentation.
Statement $B$ is correct: During mineralization,some microbes further degrade humus to release inorganic nutrients.
Statement $C$ is correct: Water-soluble inorganic nutrients go down into the soil horizon and get precipitated as unavailable salts by the process of leaching.
Statement $D$ is incorrect: The detritus food chain begins with dead organic matter (detritus),not living organisms.
Statement $E$ is incorrect: Earthworms break down detritus into smaller particles by fragmentation,not catabolism. Catabolism is the process where bacterial and fungal enzymes degrade detritus into simpler inorganic substances.
Therefore,statements $A, B,$ and $C$ are correct.

(D) Pleiotropism is a genetic phenomenon where a single gene influences two or more seemingly unrelated phenotypic traits.
When a single gene affects multiple phenotypic expressions,the gene is called a pleiotropic gene and the phenomenon is known as pleiotropism.
An example of this is the gene responsible for phenylketonuria,which affects skin pigmentation,hair color,and mental ability.

(B) The process of Recombinant $DNA$ technology follows a specific sequence:
$1$. Isolation of the genetic material $(DNA)$.
$2$. Cutting of $DNA$ at specific locations using restriction enzymes $(B)$.
$3$. Isolation of the desired $DNA$ fragment $(C)$.
$4$. Amplification of the gene of interest using $PCR$ $(D)$.
$5$. Ligation of the $DNA$ fragment into a vector.
$6$. Insertion of recombinant $DNA$ into the host cell $(A)$.
Therefore,the correct sequence is $B, C, D, A$.

(C) Algal blooms are caused by the excessive growth of planktonic algae due to nutrient enrichment (eutrophication).
These blooms impart a distinct colour to the water bodies and cause deterioration of water quality.
They also lead to fish mortality and can be toxic to human beings and animals.
Therefore,the statement that algal blooms improve water quality and promote fisheries is incorrect.

(D) Klinefelter's syndrome is a genetic disorder caused by the presence of an additional copy of the $X$-chromosome,resulting in a karyotype of $47, XXY$.
Statement $B$ is correct because individuals with this syndrome exhibit overall masculine development,but they also show some feminine characteristics (such as gynaecomastia).
Statement $E$ is correct because these individuals are sterile.
Statements $A$,$C$,and $D$ are incorrect because they describe features associated with Down's syndrome,not Klinefelter's syndrome. Down's syndrome was first described by Langdon Down in $1866$,and affected individuals are typically short-statured with retarded physical,psychomotor,and mental development.
Therefore,statements $B$ and $E$ are correct.

$(C)$ $(+,+)$ Mutualism: In this interaction, both the interacting species are benefited.
$(+, 0)$ Commensalism: Only one species is benefited and the other species remains unaffected (neither harmed nor benefited).
$(-, 0)$ Amensalism: One species is harmed while the other remains unaffected.
$(+,-)$ Parasitism: One species is benefited and the other is negatively affected (harmed).

(B) flower is considered a modified shoot because the shoot apical meristem undergoes a transformation into a floral meristem.
During this process,the internodes do not elongate,causing the floral axis to become highly condensed.
Instead of producing leaves,the apex produces various floral appendages (sepals,petals,stamens,and carpels) laterally at successive nodes.
Since the condensation of the internodes is the structural reason why the shoot is modified into a flower,both $A$ and $R$ are true,and $R$ is the correct explanation of $A$.

(D) Statement $I$ is correct: Gause's 'Competitive Exclusion Principle' states that two closely related species competing for the same resources cannot co-exist indefinitely and the competitively inferior one will be eliminated eventually.
Statement $II$ is incorrect: In general,herbivores and plants appear to be more adversely affected by competition than carnivores. Therefore,Statement $I$ is correct and Statement $II$ is false.

(A) In the $lac$ operon model,the structural genes and the regulator gene have specific functions:
$1$. Gene $z$: Codes for the enzyme $\beta$-galactosidase,which is responsible for the hydrolysis of lactose into galactose and glucose.
$2$. Gene $y$: Codes for the enzyme permease,which increases the permeability of the cell to $\beta$-galactosides.
$3$. Gene $a$: Codes for the enzyme transacetylase.
$4$. Gene $i$: Codes for the repressor protein,which binds to the operator region to prevent transcription in the absence of an inducer.
Therefore,the correct matching is: $A-II, B-III, C-IV, D-I$.

(A) Assertion $A$ is false because amniocentesis for sex determination is strictly banned in India and is $NOT$ a strategy of the Reproductive and Child Health Care $(RCH)$ programme.
The $RCH$ programme aims to create awareness about reproduction-related aspects and provide support for a healthy society.
Reason $R$ is true because the legal ban on amniocentesis is specifically intended to curb the illegal practice of female foeticide,which is a major social concern.
Therefore,$A$ is false but $R$ is true.

(B) Statement $I$ is correct: The vas deferens emerges from the epididymis and enters the abdominal cavity. It loops over the urinary bladder and receives a duct from the seminal vesicle to form the ejaculatory duct,which then opens into the urethra.
Statement $II$ is correct: The cavity of the cervix is known as the cervical canal. The cervical canal along with the vagina forms the birth canal.

(C) The correct answer is option $C$ because conventional methods of diagnosis,such as serum and urine analysis,are not sensitive enough to detect pathogens or diseases at very low concentrations,thus failing to aid in early diagnosis.
In contrast,modern molecular diagnostic techniques like Recombinant $DNA$ Technology,Polymerase Chain Reaction $(PCR)$,and Enzyme Linked Immuno-Sorbent Assay $(ELISA)$ are highly sensitive and specific,allowing for the detection of diseases long before symptoms appear,which is crucial for early treatment.

(C) The correct answer is option $C$ because,among the options provided,$HIV$ infection,genital herpes,and hepatitis-$B$ are viral infections that are generally considered incurable or chronic.
Gonorrhoea is a bacterial infection caused by the bacterium $Neisseria$ $gonorrhoeae$. It can be completely cured if detected early and treated properly with appropriate antibiotics.

(A) Option $A$ is the correct answer because a single-stranded $DNA$ or $RNA$ molecule tagged with a radioactive isotope is called a probe,and it is used for the detection of specific sequences or mutated genes.
Options $B$,$C$,and $D$ are incorrect because $BAC$ (Bacterial Artificial Chromosome),$YAC$ (Yeast Artificial Chromosome),and $pBR322$ are all well-known cloning vectors used in recombinant $DNA$ technology.

(B) leopard and a lion in a forest/grassland exemplify competition where both species compete for the same limited resources $(A-I)$.
$A$ cuckoo laying an egg in a crow's nest is a classic example of brood parasitism,where the cuckoo (parasite) lays its eggs in the nest of the crow (host) $(B-II)$.
Fungi and the roots of higher plants in mycorrhizae exemplify mutualism,where both species benefit. The fungi help the plant absorb essential nutrients,while the plant provides the fungi with carbohydrates $(C-III)$.
$A$ cattle egret and cattle in a field exemplify commensalism,where the egret benefits by catching insects flushed out by the grazing cattle,while the cattle remain unaffected $(D-IV)$.
Therefore,the correct matching is $A-I, B-II, C-III, D-IV$.

(A) Statement $A$ is correct: Non-primate mammals like cows,sheep,rats,deer,dogs,and tigers show cyclical changes during reproduction known as the oestrus cycle.
Statement $B$ is incorrect: The first menstrual cycle that begins at puberty is called menarche,not menopause. Menopause refers to the cessation of menstrual cycles at the end of the reproductive phase.
Statement $C$ is correct: Lack of menstruation is one of the most significant indicators of pregnancy,although it can also be caused by stress or poor health.
Statement $D$ is correct: Cyclic menstruation is a characteristic of the reproductive phase in human females,extending from menarche to menopause.
Therefore,statements $A, C,$ and $D$ are correct.

(C) The correct answer is $A-III, B-IV, C-II, D-I$.
$(i)$ Vasectomy is a surgical method of contraception where the vas deferens is cut or tied.
(ii) Coitus interruptus is a natural method of contraception where the male withdraws before ejaculation.
(iii) Cervical cap is a barrier method of contraception that prevents sperm from entering the uterus.
(iv) Saheli is an oral method of contraception,which is a non-steroidal pill taken once a week.

(B) The correct answer is option $B$ because $HIV$ enters into helper $T$-lymphocytes ($T_H$ cells) after entering the body of the person.
Inside these cells,the viral $RNA$ genome replicates to form viral $DNA$ with the help of the enzyme reverse transcriptase.
This viral $DNA$ gets incorporated into the host cell's $DNA$ and directs the infected cells to produce virus particles.
The $T_H$ cells act as a factory for the production of progeny viruses,which are then released into the blood to attack other helper $T$-lymphocytes.

(C) Both Assertion $A$ and Reason $R$ are true,but $R$ is not the correct explanation of $A$.
Assertion $A$ is true because the endometrium is the inner lining of the uterus where the blastocyst implants to establish pregnancy.
Reason $R$ is also true because the corpus luteum secretes progesterone,which maintains the endometrium. If fertilization does not occur,the corpus luteum degenerates,leading to a drop in progesterone levels,which causes the endometrium to disintegrate (menstruation).
However,the reason $R$ explains why the endometrium is shed during the menstrual cycle,not why the endometrium is necessary for implantation. Therefore,$R$ is not the correct explanation for $A$.

(C) Option $C$ is the correct answer because Numbat,Spotted cuscus,and Flying phalanger are all Australian marsupials that exhibit adaptive radiation.
Adaptive radiation is the process of evolution of different species in a given geographical area starting from a point and literally radiating to other areas of geography (habitats).
Option $A$ is incorrect because Lemur,Anteater,and Wolf are placental mammals.
Option $B$ is incorrect because Bobcat is a placental mammal.
Option $D$ is incorrect because Mole and Flying squirrel are placental mammals.

(B) The correct matching is:
- $A$. Heroin: It is a depressant that slows down body functions $(A-II)$.
- $B$. Marijuana: It is well-known for its significant effect on the cardiovascular system $(B-I)$.
- $C$. Cocaine: It interferes with the transport of the neurotransmitter dopamine $(C-IV)$.
- $D$. Morphine: It is a potent sedative and painkiller $(D-III)$.
Therefore, the correct sequence is $A-II, B-I, C-IV, D-III$, which corresponds to option $B$.

(B) The correct matching is as follows:
$A$. Ringworm is caused by the fungus $Trichophyton$.
$B$. Filariasis is caused by the filarial worm $Wuchereria \text{ } bancrofti$.
$C$. Malaria is caused by the protozoan $Plasmodium \text{ } vivax$.
$D$. Pneumonia is caused by the bacterium $Haemophilus \text{ } influenzae$.
Therefore, the correct sequence is $A-II, B-III, C-IV, D-I$.

(D) Statement $I$ is correct because an electrostatic precipitator is the most widely used device to remove particulate matter from the exhaust of thermal power plants.
Statement $II$ is incorrect because electrostatic precipitators are designed to remove particulate matter (dust,smoke,etc.),not ionising radiations. Ionising radiations are typically managed through shielding and containment,not by electrostatic precipitation.

(B) Down's syndrome is a chromosomal disorder caused by the presence of an additional copy of chromosome number $21$ (trisomy of $21$).
Key clinical features of Down's syndrome include:
$a.$ Broad palm with a characteristic single palm crease (simian crease).
$b.$ Short stature with a small,round head.
$c.$ Furrowed tongue and partially open mouth.
$d.$ Physical,psychomotor,and mental development is retarded.

(A) Statement $I$ is incorrect because $DNA$ is negatively charged due to the presence of phosphate groups,and it is held by positively charged proteins in prokaryotes.
Statement $II$ is correct because in eukaryotes,the negatively charged $DNA$ wraps around the positively charged histone octamer to form a nucleosome.
Therefore,Statement $I$ is false and Statement $II$ is true.

(C) Biomagnification is defined as the increase in the concentration of a toxicant at successive trophic levels.
$A$ large amount of nutrients in water promotes the growth of algal blooms,which leads to oxygen depletion and increases fish mortality.
Eutrophication is the natural aging of a lake by nutrient enrichment of its water.

(B) $RNA$ is chemically more reactive and structurally less stable than $DNA$ due to the presence of a $2'$-$OH$ group in its ribose sugar.
Because of this instability,$RNA$ mutates at a much faster rate compared to $DNA$.
Viruses that possess an $RNA$ genome and have a short life cycle replicate rapidly,which allows them to accumulate mutations quickly and evolve at a faster rate.

(C) In human pedigree analysis,standard symbols are used to represent different family relationships and traits.
- $A$ single horizontal line between a square (male) and a circle (female) represents mating.
- $A$ double horizontal line between a square and a circle represents mating between relatives,also known as consanguineous mating.
- Therefore,the symbol shown in option $C$ represents mating between relatives.

(B) Logistic growth occurs when there is limited resource availability, leading to a sigmoid curve.
Exponential growth occurs when there is unlimited resource availability, leading to a $J$-shaped curve.
An expanding age pyramid represents a growing population where the percentage of individuals in the pre-reproductive age group is the largest, followed by the reproductive and post-reproductive age groups.
$A$ stable age pyramid represents a stable population where the percentage of individuals in the pre-reproductive and reproductive age groups are approximately the same.
Therefore, the correct matching is $A-II, B-I, C-III, D-IV$.

(D) In the process of transcription,the coding strand of $DNA$ has the same sequence as the mRNA,except that thymine $(T)$ is present in the $DNA$ instead of uracil $(U)$ in the $RNA$.
Given mRNA sequence: $5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'$
By replacing uracil $(U)$ with thymine $(T)$,we obtain the sequence of the coding strand:
Coding strand sequence: $5' ATCGATCGATCGATCGATCGATCGATCG 3'$
Therefore,the correct option is $D$.

(B) Inbreeding refers to the mating of more closely related individuals within the same breed for $4-6$ generations.
$1$. Inbreeding increases homozygosity,which is essential for developing a pure line in any animal.
$2$. It exposes harmful recessive genes that are then eliminated by selection.
$3$. It helps in the accumulation of superior genes and the elimination of less desirable genes.
$4$. However,continued inbreeding,especially close inbreeding,usually reduces fertility and productivity,which is known as inbreeding depression. Therefore,decreasing the productivity of an inbred population is a disadvantage,not an advantage.
Thus,option $B$ is the correct answer as it incorrectly states that inbreeding decreases homozygosity (it actually increases it).