Which one of the following is the sequence on | vedclass

Name: Exam Paper Generator | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

(D) In the process of transcription,the coding strand of $DNA$ has the same sequence as the mRNA,except that thymine $(T)$ is present in the $DNA$ ins

Vedclass · Accepted Answer

$5' ATCGATCGATCGATCGATCGATCGATCG 3'$

Vedclass · Answer

(D) In the process of transcription,the coding strand of $DNA$ has the same sequence as the mRNA,except that thymine $(T)$ is present in the $DNA$ instead of uracil $(U)$ in the $RNA$.Given mRNA sequence: $5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'$By replacing uracil $(U)$ with thymine $(T)$,we obtain the sequence of the coding strand:Coding strand sequence: $5' ATCGATCGATCGATCGATCGATCGATCG 3'$Therefore,the correct option is $D$.

Which one of the following is the sequence on the corresponding coding strand,if the sequence on the mRNA formed is as follows $5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'$?

Similar Questions

Transcription is defined as.........

The unit of transcription in $DNA$ is known as:

Give an account of post-transcriptional modifications of a eukaryotic $mRNA$.

If the template strand of $DNA$ is $3'-CTGATAGC-5'$,what will be the sequence of the transcribed $RNA$?

In which direction is $m-RNA$ synthesized on a $DNA$ template?

Vedclass Test Series

Exam Paper Generator

Online Exam Module