Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?
- [NEET 2023]
- A
$3' ATCGATCGATCGATCGATCGATCGATCG 5'$
- B
$5' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3'$
- C
$3' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5'$
- D
$5'ATCGATCGATCGATCGATCGATCGATCG 3 '$
Similar Questions
Genes that are involved in turning on or off the transcription of a set of structural genes are called:
Genes that are involved in turning on or off the transcription of a set of structural genes are called:
When a mature $mRNA$ was hybridised to its gene certain loops were observed. These loops represent
When a mature $mRNA$ was hybridised to its gene certain loops were observed. These loops represent
Full Forms : $mRNA$ & $tRNA$
Full Forms : $mRNA$ & $tRNA$
Given below is the sequence of coding strand of $DNA$ in a transcription unit $\rm {AATGCAGCTATTAGG} - 5^{\prime}$ write the sequence of $(a)$ its complementary strand $(b)$ the $mRNA$
Given below is the sequence of coding strand of $DNA$ in a transcription unit $\rm {AATGCAGCTATTAGG} - 5^{\prime}$ write the sequence of $(a)$ its complementary strand $(b)$ the $mRNA$