Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?
- [NEET 2023]
- A
$3' ATCGATCGATCGATCGATCGATCGATCG 5'$
- B
$5' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3'$
- C
$3' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5'$
- D
$5'ATCGATCGATCGATCGATCGATCGATCG 3 '$
Similar Questions
Complementary $DNA\ (cDNA)$ is complementary to
Complementary $DNA\ (cDNA)$ is complementary to
Removal of introns and joining the exons in a defined order in a transcription unit is called
Removal of introns and joining the exons in a defined order in a transcription unit is called
- [AIPMT 2009]
One functional unit of gene which specifies synthesis of one polypeptide is known as
Write short note on Transcription unit.
Write short note on Transcription unit.
One strand of the given segment of $DNA$ codes for $mRNA$ having the sequence $AUC, GCG, UCA$ needed for synthesis of proteins. The strand by which $DNA$ molecule will be responsible for the above $mRNA$ sequence is
One strand of the given segment of $DNA$ codes for $mRNA$ having the sequence $AUC, GCG, UCA$ needed for synthesis of proteins. The strand by which $DNA$ molecule will be responsible for the above $mRNA$ sequence is