In tailing, adenylate residues are added at $3'$ end
In tailing, adenylate residues are added at $3'$ end
- A
With the help of gyanyl transferase
- B
In a template independent manner
- C
With the help of methyl transferase
- D
Of hn-$RNA$ of $E.$coli
Similar Questions
Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?
$3$'$TACATGGCAAATATCCATTCA5'$
Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?
$3$'$TACATGGCAAATATCCATTCA5'$
- [NEET 2024]
Identify the correct statement.
Identify the correct statement.
- [NEET 2021]
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?
- [NEET 2023]
Formation of $RNA$ strand on template $DNA$ is
Formation of $RNA$ strand on template $DNA$ is
Non-genetic $RNA$ is of
Non-genetic $RNA$ is of