In tailing, adenylate residues are added at $3'$ end

  • A

    With the help of gyanyl transferase

  • B

    In a template independent manner

  • C

    With the help of methyl transferase

  • D

    Of hn-$RNA$ of $E.$coli

Similar Questions

Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?

$3$'$TACATGGCAAATATCCATTCA5'$

  • [NEET 2024]

Identify the correct statement.

  • [NEET 2021]

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?

  • [NEET 2023]

Formation of $RNA$ strand on template $DNA$ is

Non-genetic $RNA$ is of