In tailing, adenylate residues are added at $3'$ end
With the help of gyanyl transferase
In a template independent manner
With the help of methyl transferase
Of hn-$RNA$ of $E.$coli
Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?
$3$'$TACATGGCAAATATCCATTCA5'$
Identify the correct statement.
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?
Formation of $RNA$ strand on template $DNA$ is
Non-genetic $RNA$ is of