Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?

$3$'$TACATGGCAAATATCCATTCA5'$

  • [NEET 2024]
  • A

    $5'AUGUAAAGUUUAUAGGUAAGU3'$

  • B

     $5'AUGUACCGUUUAUAGGGAAGU3'$

  • C

    $5'ATGTACCGTTTATAGGTAAGT3'$

  • D

     $5'AUGUACCGUUUAUAGGUAAGU3'$

Similar Questions

Which of the following is nongenetic, which is utilised for protein synthesis

  • [AIIMS 1998]

Removal of $RNA$ polymerase $III$ from nucleoplasm will affect the synthesis of

  • [AIPMT 2012]

In eukaryotes $mRNA$ transcribed is called

mRNA is a polymer of

In the process of transcription in Eukaryotes, the $RNA$ polymerase $I$ transcribes

  • [NEET 2019]