Which one is the correct product of DNA depen | vedclass

Name: Exam Paper Generator | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

(D) The process of transcription involves the synthesis of $RNA$ from a $DNA$ template strand.The $DNA$ template strand is given as: $3'TACATGGCAAATAT

Vedclass · Accepted Answer

$5'AUGUACCGUUUAUAGGUAAGU3'$

Vedclass · Answer

(D) The process of transcription involves the synthesis of $RNA$ from a $DNA$ template strand.The $DNA$ template strand is given as: $3'TACATGGCAAATATCCATTCA5'$.According to the base-pairing rules for $RNA$ synthesis:$A$ (Adenine) in $DNA$ pairs with $U$ (Uracil) in $RNA$.$T$ (Thymine) in $DNA$ pairs with $A$ (Adenine) in $RNA$.$C$ (Cytosine) in $DNA$ pairs with $G$ (Guanine) in $RNA$.$G$ (Guanine) in $DNA$ pairs with $C$ (Cytosine) in $RNA$.Applying these rules to the template $3'TACATGGCAAATATCCATTCA5'$:$T \rightarrow A$$A \rightarrow U$$C \rightarrow G$$A \rightarrow U$$T \rightarrow A$$G \rightarrow C$$G \rightarrow C$$C \rightarrow G$$A \rightarrow U$$A \rightarrow U$$A \rightarrow U$$T \rightarrow A$$A \rightarrow U$$T \rightarrow A$$C \rightarrow G$$C \rightarrow G$$A \rightarrow U$$T \rightarrow A$$T \rightarrow A$$C \rightarrow G$$A \rightarrow U$Thus,the resulting $mRNA$ sequence in the $5' \rightarrow 3'$ direction is: $5'AUGUACCGUUUAUAGGUAAGU3'$.

Which one is the correct product of $DNA$ dependent $RNA$ polymerase for the given template strand?
$3'TACATGGCAAATATCCATTCA5'$

Similar Questions

Transcription is a process by which

The $DNA$ strand on which $DNA$-dependent $RNA$ polymerase catalyzes transcription is called:

Which process is represented in the given figure?

Which of the following is not a part of a transcription unit in $DNA$?

In $DNA$,the promoter is the initiation site for .......

Vedclass Test Series

Exam Paper Generator

Online Exam Module

Which one is the correct product of $DNA$ dependent $RNA$ polymerase for the given template strand?$3'TACATGGCAAATATCCATTCA5'$