Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?
$3$'$TACATGGCAAATATCCATTCA5'$
$5'AUGUAAAGUUUAUAGGUAAGU3'$
$5'AUGUACCGUUUAUAGGGAAGU3'$
$5'ATGTACCGTTTATAGGTAAGT3'$
$5'AUGUACCGUUUAUAGGUAAGU3'$
Which of the following is nongenetic, which is utilised for protein synthesis
Removal of $RNA$ polymerase $III$ from nucleoplasm will affect the synthesis of
In eukaryotes $mRNA$ transcribed is called
In the process of transcription in Eukaryotes, the $RNA$ polymerase $I$ transcribes