Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?
$3$'$TACATGGCAAATATCCATTCA5'$
Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?
$3$'$TACATGGCAAATATCCATTCA5'$
- [NEET 2024]
- A
$5'AUGUAAAGUUUAUAGGUAAGU3'$
- B
$5'AUGUACCGUUUAUAGGGAAGU3'$
- C
$5'ATGTACCGTTTATAGGTAAGT3'$
- D
$5'AUGUACCGUUUAUAGGUAAGU3'$
Similar Questions
Which of the following is nongenetic, which is utilised for protein synthesis
Which of the following is nongenetic, which is utilised for protein synthesis
- [AIIMS 1998]
Removal of $RNA$ polymerase $III$ from nucleoplasm will affect the synthesis of
Removal of $RNA$ polymerase $III$ from nucleoplasm will affect the synthesis of
- [AIPMT 2012]
In eukaryotes $mRNA$ transcribed is called
In eukaryotes $mRNA$ transcribed is called
mRNA is a polymer of
In the process of transcription in Eukaryotes, the $RNA$ polymerase $I$ transcribes
In the process of transcription in Eukaryotes, the $RNA$ polymerase $I$ transcribes
- [NEET 2019]