If there are $81\; million$ bases in $RNA$ of human cell, then calculate the total number of introns present in $cDNA$

  • A

    $27\; millions$

  • B

    Zero

  • C

    Equal to ribonucleotides

  • D

    Half the number of ribonucleotides

Similar Questions

If one strand of $DNA$ has the nitrogenous base sequence as $ATCTG$, what would be the complementary $RNA$ strand sequence?

  • [AIPMT 2012]

Match the following $RNA$ polymerase with their transcribed products

$(a) \;RNA$ polymerase $I$  $(i) \;tRNA$
$(b) \;RNA$ polymerase $II $ $(ii)\; rRNA$
$(c)\; RNA$ polymerase $III $ $(iii) \;hnRNA$

Select the correct option from the following

  • [NEET 2019]

The equivalent of a structural gene is

  • [NEET 2016]

Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?

$3$'$TACATGGCAAATATCCATTCA5'$

  • [NEET 2024]

Describe Transcription.