If there are $81\; million$ bases in $RNA$ of human cell, then calculate the total number of introns present in $cDNA$
$27\; millions$
Zero
Equal to ribonucleotides
Half the number of ribonucleotides
If one strand of $DNA$ has the nitrogenous base sequence as $ATCTG$, what would be the complementary $RNA$ strand sequence?
Match the following $RNA$ polymerase with their transcribed products
$(a) \;RNA$ polymerase $I$ | $(i) \;tRNA$ |
$(b) \;RNA$ polymerase $II $ | $(ii)\; rRNA$ |
$(c)\; RNA$ polymerase $III $ | $(iii) \;hnRNA$ |
Select the correct option from the following
The equivalent of a structural gene is
Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?
$3$'$TACATGGCAAATATCCATTCA5'$
Describe Transcription.