If there are $81\; million$ bases in $RNA$ of human cell, then calculate the total number of introns present in $cDNA$
If there are $81\; million$ bases in $RNA$ of human cell, then calculate the total number of introns present in $cDNA$
- A
$27\; millions$
- B
Zero
- C
Equal to ribonucleotides
- D
Half the number of ribonucleotides
Similar Questions
If one strand of $DNA$ has the nitrogenous base sequence as $ATCTG$, what would be the complementary $RNA$ strand sequence?
If one strand of $DNA$ has the nitrogenous base sequence as $ATCTG$, what would be the complementary $RNA$ strand sequence?
- [AIPMT 2012]
Match the following $RNA$ polymerase with their transcribed products
$(a) \;RNA$ polymerase $I$
$(i) \;tRNA$
$(b) \;RNA$ polymerase $II $
$(ii)\; rRNA$
$(c)\; RNA$ polymerase $III $
$(iii) \;hnRNA$
Select the correct option from the following
Match the following $RNA$ polymerase with their transcribed products
| $(a) \;RNA$ polymerase $I$ | $(i) \;tRNA$ |
| $(b) \;RNA$ polymerase $II $ | $(ii)\; rRNA$ |
| $(c)\; RNA$ polymerase $III $ | $(iii) \;hnRNA$ |
Select the correct option from the following
- [NEET 2019]
The equivalent of a structural gene is
The equivalent of a structural gene is
- [NEET 2016]
Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?
$3$'$TACATGGCAAATATCCATTCA5'$
Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?
$3$'$TACATGGCAAATATCCATTCA5'$
- [NEET 2024]
Describe Transcription.
Describe Transcription.