The equivalent of a structural gene is
The equivalent of a structural gene is
- [NEET 2016]
- A
muton
- B
cistron
- C
operon
- D
recon.
Similar Questions
Explain (in one or two lines) the function of the followings:
$(a)$ Promoter
$(b)$ $tRNA$
$(c)$ Exons
Explain (in one or two lines) the function of the followings:
$(a)$ Promoter
$(b)$ $tRNA$
$(c)$ Exons
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?
- [NEET 2023]
$A$ : $5\;S rRNA$ and surrounding protein complex provides binding site of $tRNA$.
$R$ : $tRNA$ is soluble $RNA$ with unusual bases
$A$ : $5\;S rRNA$ and surrounding protein complex provides binding site of $tRNA$.
$R$ : $tRNA$ is soluble $RNA$ with unusual bases
If the sequence of one strand of $DNA$ is written as follows:
$5'- ATGCATGCATGCATGCATGCATGCATGC-3'$
Write down the sequence of complementary strand in $5^{\prime} \rightarrow 3^{\prime}$ direction
If the sequence of one strand of $DNA$ is written as follows:
$5'- ATGCATGCATGCATGCATGCATGCATGC-3'$
Write down the sequence of complementary strand in $5^{\prime} \rightarrow 3^{\prime}$ direction
Full Forms : $rRNA$
Full Forms : $rRNA$