જો mRNAની હરોળ નીચે પ્રમાણેની હોય તો, નીચે જણ | vedclass

Name: PDF Generator App | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

The sequence of coding strand is same as RNA except thymine at the place of uracil.

Template strand $\rightarrow$ 3'-TAGCTAGCTAGCTAGCTAGCTAGCTA

Vedclass · Accepted Answer

$5'ATCGATCGATCGATCGATCGATCGATCG 3 '$

Vedclass · Answer

The sequence of coding strand is same as RNA except thymine at the place of uracil.

Template strand $\rightarrow$ 3'-TAGCTAGCTAGCTAGCTAGCTAGCTAGC-5'

Coding strand $\rightarrow$ 5'-ATCGATCGATCG ATCGATCGATCGATCG-3'

$\downarrow$ Transcription

mRNA $\rightarrow$ 5' AUCGAUCGAUCGAUCGAUCGAUCG AUCG $3 '$

જો $mRNA$ની હરોળ નીચે પ્રમાણેની હોય તો, નીચે જણાવેલ કર શૃંખલા સાંકેતિક શૃંખલામાં બંધબેસતી શૃંખલા હશે?

$5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$

Similar Questions

$DNA$ ના એક શૃંખલાના બેઈઝ ક્રમ $GAT, TAG, CAT, GAC$ છે, તો તેના પૂરક શૃંખલાનો ક્રમ શું હોઈ શકે?

પોલી $A$ પુચ્છ શેમાં હાજર હોય છે?

નીચે આપેલી વ્યાખ્યા આપો :

$1.$ સમાપન સંકેત

$2.$ સિસ્ટ્રોન

$snRNAs$ એટલે

જો $mRNA$ની હરોળ નીચે પ્રમાણેની હોય તો, નીચે જણાવેલ કર શૃંખલા સાંકેતિક શૃંખલામાં બંધબેસતી શૃંખલા હશે? $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$