Which of the following is responsible for transcription of $t-RNA$ and $snRNAs$
$DNA$ polymerase - $I$
$RNA$ polymerase - $II$
$RNA$ polymerase - $III$
$DNA$ polymerase - $II$
What function is performed by sigma factor and rho factor in the process of transcription
Full Forms : $SnRNA$
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?
$A$ : $5\;S rRNA$ and surrounding protein complex provides binding site of $tRNA$.
$R$ : $tRNA$ is soluble $RNA$ with unusual bases
Identify the incorrect statement.