Which of the following is responsible for transcription of $t-RNA$ and $snRNAs$

  • A

    $DNA$ polymerase - $I$

  • B

    $RNA$ polymerase - $II$

  • C

    $RNA$ polymerase - $III$

  • D

    $DNA$ polymerase - $II$

Similar Questions

What function is performed by sigma factor and rho factor in the process of transcription

Full Forms : $SnRNA$

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?

  • [NEET 2023]

$A$ : $5\;S rRNA$ and surrounding protein complex provides binding site of $tRNA$.
$R$ : $tRNA$ is soluble $RNA$ with unusual bases

Identify the incorrect statement.