Which of the following is responsible for transcription of $t-RNA$ and $snRNAs$
Which of the following is responsible for transcription of $t-RNA$ and $snRNAs$
- A
$DNA$ polymerase - $I$
- B
$RNA$ polymerase - $II$
- C
$RNA$ polymerase - $III$
- D
$DNA$ polymerase - $II$
Similar Questions
What function is performed by sigma factor and rho factor in the process of transcription
What function is performed by sigma factor and rho factor in the process of transcription
Full Forms : $SnRNA$
Full Forms : $SnRNA$
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?
- [NEET 2023]
$A$ : $5\;S rRNA$ and surrounding protein complex provides binding site of $tRNA$.
$R$ : $tRNA$ is soluble $RNA$ with unusual bases
$A$ : $5\;S rRNA$ and surrounding protein complex provides binding site of $tRNA$.
$R$ : $tRNA$ is soluble $RNA$ with unusual bases
Identify the incorrect statement.
Identify the incorrect statement.