$A$ : $5\;S rRNA$ and surrounding protein complex provides binding site of $tRNA$.
$R$ : $tRNA$ is soluble $RNA$ with unusual bases
$A$ : $5\;S rRNA$ and surrounding protein complex provides binding site of $tRNA$.
$R$ : $tRNA$ is soluble $RNA$ with unusual bases
- A
Assertion and Reason both are correct and also correct explanation.
- B
Assertion and Reason both are correct but not explanation of assertion.
- C
Assertion is correct, but Reason is incorrect.
- D
Both Assertion and Reason are incorrect.
Similar Questions
In capping .......... is added to the $5'$ end of hn $RNA$
In capping .......... is added to the $5'$ end of hn $RNA$
Explain (in one or two lines) the function of the followings:
$(a)$ Promoter
$(b)$ $tRNA$
$(c)$ Exons
Explain (in one or two lines) the function of the followings:
$(a)$ Promoter
$(b)$ $tRNA$
$(c)$ Exons
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?
- [NEET 2023]
Describe Transcription.
Describe Transcription.