What initiation and termination factors are involved in transcription in Eukaryotes ?
$\alpha$ and $\sigma,$ respectively
$\alpha$ and $\beta,$ respectively
$\beta$ and $\gamma,$ respectively
$\sigma$ and $\rho,$ respectively
Which of the following is nongenetic, which is utilised for protein synthesis
Which one of the following is not a part of a transcription unit in $DNA$ ?
One strand of the given segment of $DNA$ codes for $mRNA$ having the sequence $AUC, GCG, UCA$ needed for synthesis of proteins. The strand by which $DNA$ molecule will be responsible for the above $mRNA$ sequence is
Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?
$3$'$TACATGGCAAATATCCATTCA5'$
Name the enzyme that facilitates opening of $DNA$ helix during transcription.