What initiation and termination factors are involved in transcription in Eukaryotes ?

  • [NEET 2019]
  • A

    $\alpha$ and $\sigma,$ respectively

  • B

    $\alpha$ and $\beta,$ respectively

  • C

    $\beta$ and $\gamma,$ respectively

  • D

    $\sigma$ and $\rho,$ respectively

Similar Questions

Which of the following is nongenetic, which is utilised for protein synthesis

  • [AIIMS 1998]

Which one of the following is not a part of a transcription unit in $DNA$ ?

  • [AIPMT 2012]

One strand of the given segment of $DNA$ codes for $mRNA$ having the sequence $AUC, GCG, UCA$ needed for synthesis of proteins. The strand by which $DNA$ molecule will be responsible for the above $mRNA$ sequence is

Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?

$3$'$TACATGGCAAATATCCATTCA5'$

  • [NEET 2024]

Name the enzyme that facilitates opening of $DNA$ helix during transcription.

  • [NEET 2020]