Distinguish between transcription in prokaryo | vedclass

Name: Exam Paper Generator | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

(N/A)       Transcription in Prokaryotes    Transcription in Eukaryotes        $1$. Transcription products are functional in $situ$.    $1$. Transcrip

Vedclass · Accepted Answer

Vedclass · Answer

(N/A)       Transcription in Prokaryotes    Transcription in Eukaryotes        $1$. Transcription products are functional in $situ$.    $1$. Transcription products must be transported out of the nucleus to the cytoplasm to become functional.        $2$. Only a single type of $RNA$ polymerase is involved.    $2$. Three distinct types of $RNA$ polymerases $(I, II, III)$ are involved.        $3$. $mRNA$ is polycistronic.    $3$. $mRNA$ is monocistronic.        $4$. Splicing is not required as there are no introns.    $4$. Splicing is required to remove introns from the primary transcript.

Distinguish between transcription in prokaryotes and eukaryotes.

Similar Questions

Which enzyme is used for transcription?

The process of transcription follows which principle?

Splicing of $RNA$ means......

Which one is the correct product of $DNA$ dependent $RNA$ polymerase for the given template strand?
$3'TACATGGCAAATATCCATTCA5'$

Which $RNA$ is formed after the maturation of $hnRNA$?

Vedclass Test Series

Exam Paper Generator

Online Exam Module

Transcription in Prokaryotes	Transcription in Eukaryotes
$1$. Transcription products are functional in $situ$.	$1$. Transcription products must be transported out of the nucleus to the cytoplasm to become functional.
$2$. Only a single type of $RNA$ polymerase is involved.	$2$. Three distinct types of $RNA$ polymerases $(I, II, III)$ are involved.
$3$. $mRNA$ is polycistronic.	$3$. $mRNA$ is monocistronic.
$4$. Splicing is not required as there are no introns.	$4$. Splicing is required to remove introns from the primary transcript.