: Choose incorrect sentence for $RNA$.
: Choose incorrect sentence for $RNA$.
- A
$RNA$ is useful for protein synthesis.
- B
$t-RNA$ brings amino acids and reads the genetic code.
- C
$RNA$ contains two polynucleotide chain.
- D
During translation $r-RNA$ act as catalyst.
Similar Questions
Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?
$3$'$TACATGGCAAATATCCATTCA5'$
Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?
$3$'$TACATGGCAAATATCCATTCA5'$
- [NEET 2024]
Which is the "Only enzyme" that has "Capability" to catalyse Initiation, Elongation and Termination in the process of transcription in prokaryotes?
Which is the "Only enzyme" that has "Capability" to catalyse Initiation, Elongation and Termination in the process of transcription in prokaryotes?
- [NEET 2021]
Transcription
Transcription
There is only one possible sequence of amino acids when deduced from a given nucleotides. But multiple nucleotides sequence can be deduced from a single amino acid sequence. Explain this phenomena.
There is only one possible sequence of amino acids when deduced from a given nucleotides. But multiple nucleotides sequence can be deduced from a single amino acid sequence. Explain this phenomena.
Which $RNA$ carries information from $DNA$ in protein synthesis
Which $RNA$ carries information from $DNA$ in protein synthesis