: Choose incorrect sentence for $RNA$.
$RNA$ is useful for protein synthesis.
$t-RNA$ brings amino acids and reads the genetic code.
$RNA$ contains two polynucleotide chain.
During translation $r-RNA$ act as catalyst.
Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?
$3$'$TACATGGCAAATATCCATTCA5'$
Which is the "Only enzyme" that has "Capability" to catalyse Initiation, Elongation and Termination in the process of transcription in prokaryotes?
Transcription
There is only one possible sequence of amino acids when deduced from a given nucleotides. But multiple nucleotides sequence can be deduced from a single amino acid sequence. Explain this phenomena.
Which $RNA$ carries information from $DNA$ in protein synthesis