: Choose incorrect sentence for $RNA$.

  • A

    $RNA$ is useful for protein synthesis.

  • B

    $t-RNA$ brings amino acids and reads the genetic code.

  • C

    $RNA$ contains two polynucleotide chain.

  • D

    During translation $r-RNA$ act as catalyst.

Similar Questions

Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?

$3$'$TACATGGCAAATATCCATTCA5'$

  • [NEET 2024]

Which is the "Only enzyme" that has "Capability" to catalyse Initiation, Elongation and Termination in the process of transcription in prokaryotes?

  • [NEET 2021]

Transcription

There is only one possible sequence of amino acids when deduced from a given nucleotides. But multiple nucleotides sequence can be deduced from a single amino acid sequence. Explain this phenomena.

Which $RNA$ carries information from $DNA$ in protein synthesis