Which one of the following is not a part of a | vedclass

Name: PDF Generator App | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

(a) : A transcription unit is a part of $DNA$ that is able to transcribe a complete $RNA$. It consists of a promoter region (where $RNA$ polymerase bi

Vedclass · Accepted Answer

The inducer

Vedclass · Answer

(a) : A transcription unit is a part of $DNA$ that is able to transcribe a complete $RNA$. It consists of a promoter region (where $RNA$ polymerase binds to start transcription), the structural gene (coding region) and the terminator region (that signals release of $RNA$ polymerase and newly formed $RNA$ strand).

Which one of the following is not a part of a transcription unit in $DNA$ ?

Similar Questions

Full Forms : $SnRNA$

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?

The process by which $DNA$ of nucleus passes genetic information to $mRNA$

What is the role of $RNA$ polymerase $III$ in the process of transcription in eukaryotes?

$DNA$ sequence that code for protein are knows as