Which one of the following is not a part of a transcription unit in $DNA$ ?
The inducer
A terminator
A promoter
The structural gene
Full Forms : $SnRNA$
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?
The process by which $DNA$ of nucleus passes genetic information to $mRNA$
What is the role of $RNA$ polymerase $III$ in the process of transcription in eukaryotes?
$DNA$ sequence that code for protein are knows as