Which one of the following is not a part of a transcription unit in $DNA$ ?

  • [AIPMT 2012]
  • A

    The inducer

  • B

    A terminator

  • C

    A promoter

  • D

    The structural gene

Similar Questions

Full Forms : $SnRNA$

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?

  • [NEET 2023]

The process by which $DNA$ of nucleus passes genetic information to $mRNA$

  • [AIIMS 1980]

What is the role of $RNA$ polymerase $III$ in the process of transcription in eukaryotes?

  • [NEET 2021]

$DNA$ sequence that code for protein are knows as