Transcription is a process by which

  • A

    Amino acids are joined to form polypeptides

  • B

    An RNA molecule is synthesized on a $DNA$ template

  • C

    An $RNA$ molecule is synthesized within a ribosome

  • D

    Two daughter strands of $DNA$ are synthesized

Similar Questions

Give scientific reasons : Transcription and translation could be coupled in prokaryotic cell but not in eukaryotic cell.

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?

  • [NEET 2023]

What is meant by sense strand

If the $DNA$ strand has the nitrogenous base sequence $ATTGCC$, the $mRNA$ will have

Transcription of $DNA$ is aided by