Transcription is a process by which
Amino acids are joined to form polypeptides
An RNA molecule is synthesized on a $DNA$ template
An $RNA$ molecule is synthesized within a ribosome
Two daughter strands of $DNA$ are synthesized
Give scientific reasons : Transcription and translation could be coupled in prokaryotic cell but not in eukaryotic cell.
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?
What is meant by sense strand
If the $DNA$ strand has the nitrogenous base sequence $ATTGCC$, the $mRNA$ will have
Transcription of $DNA$ is aided by