New strand on a $DNA$ template is initiated by
New strand on a $DNA$ template is initiated by
- A
$RNA$ polymerase
- B
$DNA$ polymerase
- C
$DNA$ ligase
- D
None of the above
Similar Questions
Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?
$3$'$TACATGGCAAATATCCATTCA5'$
Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?
$3$'$TACATGGCAAATATCCATTCA5'$
- [NEET 2024]
If there are $81\; million$ bases in $RNA$ of human cell, then calculate the total number of introns present in $cDNA$
If there are $81\; million$ bases in $RNA$ of human cell, then calculate the total number of introns present in $cDNA$
Give scientific reasons : Both the strands of $DNA$ are not copied during transcription.
Give scientific reasons : Both the strands of $DNA$ are not copied during transcription.
$A$ - The process of splicing represents the dominance of $RNA$ word.
$R$ - The presence of introns is reminiscent of antiquity.
$A$ - The process of splicing represents the dominance of $RNA$ word.
$R$ - The presence of introns is reminiscent of antiquity.
Transcription of $DNA$ is aided by
Transcription of $DNA$ is aided by