In eukaryotes,the RNA polymerase that synthes | vedclass

Name: Exam Paper Generator | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

(C) In eukaryotes,there are three types of $RNA$ polymerases in the nucleus:$1$. $RNA$ polymerase $I$ transcribes $rRNA$ ($28S, 18S,$ and $5.8S$).$2$.

Vedclass · Accepted Answer

$III, 5 S$

Vedclass · Answer

(C) In eukaryotes,there are three types of $RNA$ polymerases in the nucleus:$1$. $RNA$ polymerase $I$ transcribes $rRNA$ ($28S, 18S,$ and $5.8S$).$2$. $RNA$ polymerase $II$ transcribes precursor of $mRNA$,the heterogeneous nuclear $RNA$ $(hnRNA)$.$3$. $RNA$ polymerase $III$ is responsible for the transcription of $tRNA$,$5S$ $rRNA$,and $snRNA$ (small nuclear $RNA$).Therefore,$RNA$ polymerase $III$ synthesizes $tRNA$ and $5S$ $rRNA$.

Column-$I$	Column-$II$
$(a)$ Splicing	$(1)$ Contains only exons
$(b)$ Capping	$(2)$ Addition of adenylate residues
$(c)$ Tailing	$(3)$ Removal of introns
$(d)$ $mRNA$	$(4)$ Addition of methyl guanosine triphosphate

In eukaryotes,the $RNA$ polymerase that synthesises $tRNA$ is $RNA$ polymerase . . . . . . and is also responsible for formation of . . . . . . $rRNA$.

Similar Questions

The unit of transcription in $DNA$ is known as:

Which specific processes does $hnRNA$ undergo in eukaryotic cells?

Which one of the following processes occurs inside the nucleus during protein synthesis in eukaryotic cells?

Which one of the following is the sequence on the corresponding coding strand,if the sequence on the mRNA formed is as follows $5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'$?

Match the following columns:
Column-$I$ Column-$II$
$(a)$ Splicing $(1)$ Contains only exons
$(b)$ Capping $(2)$ Addition of adenylate residues
$(c)$ Tailing $(3)$ Removal of introns
$(d)$ $mRNA$ $(4)$ Addition of methyl guanosine triphosphate

Vedclass Test Series

Exam Paper Generator

Online Exam Module