In eukaryotes, mRNA is synthesized with the a | vedclass

Name: PDF Generator App | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

In eukaryotes, $RNA$ polymerase are of $3$ types: $(i) RNA$ polymerase $I$ : Transcribes$ rRNA$ $(285 S, 18 S, 5.8 S) .1 t$ is found in nucleolus. fou

Vedclass · Accepted Answer

$RNA polmerase II.$

Vedclass · Answer

In eukaryotes, $RNA$ polymerase are of $3$ types: $(i) RNA$ polymerase $I$ : Transcribes$ rRNA$ $(285 S, 18 S, 5.8 S) .1 t$ is found in nucleolus. found in nucleoplasm. $(iii)$ RNA polymerase. $III$ : Transcribes $tRNA$, $5 S rRNA$ and $SnRNA$ (small nuclear $RNAs$). It is found in nucleoplasm.

In eukaryotes, $mRNA$ is synthesized with the aid of

Similar Questions

Prokaryotic transcription mechanism requires involvement of only one polymerase type and
$(a)$ It occurs in cytoplasm only
$(b)$ It is often coupled with translation
$(c)$ It does not require splicing but capping is essential

Do you think that the alternate splicing of exons may enable a structural gene to code for several isoproteins from one and the same gene ? If yes, how ? If not, why so ?

Which form of $RNA$ is most heterogeneous

Genes that are involved in turning on or off the transcription of a set of structural genes are called:

Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?

$3$'$TACATGGCAAATATCCATTCA5'$