In eukaryotes, $mRNA$ is synthesized with the aid of

  • A

    $RNA polymerase III.$

  • B

    $RNA polmerase II.$

  • C

    $RNA polymerase I.$

  • D

    $reverse transcriptase.$

Similar Questions

Prokaryotic transcription mechanism requires involvement of only one polymerase type and
$(a)$ It occurs in cytoplasm only
$(b)$ It is often coupled with translation
$(c)$ It does not require splicing but capping is essential

Do you think that the alternate splicing of exons may enable a structural gene to code for several isoproteins from one and the same gene ? If yes, how ? If not, why so ?

Which form of $RNA$ is most heterogeneous

Genes that are involved in turning on or off the transcription of a set of structural genes are called:

Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?

$3$'$TACATGGCAAATATCCATTCA5'$

  • [NEET 2024]