In eukaryotes, $mRNA$ is synthesized with the aid of
$RNA polymerase III.$
$RNA polmerase II.$
$RNA polymerase I.$
$reverse transcriptase.$
Prokaryotic transcription mechanism requires involvement of only one polymerase type and
$(a)$ It occurs in cytoplasm only
$(b)$ It is often coupled with translation
$(c)$ It does not require splicing but capping is essential
Do you think that the alternate splicing of exons may enable a structural gene to code for several isoproteins from one and the same gene ? If yes, how ? If not, why so ?
Which form of $RNA$ is most heterogeneous
Genes that are involved in turning on or off the transcription of a set of structural genes are called:
Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?
$3$'$TACATGGCAAATATCCATTCA5'$