If the sequence of one strand of $DNA$ is written as follows:
$5'- ATGCATGCATGCATGCATGCATGCATGC-3'$
Write down the sequence of complementary strand in $5^{\prime} \rightarrow 3^{\prime}$ direction
If the sequence of one strand of $DNA$ is written as follows:
$5'- ATGCATGCATGCATGCATGCATGCATGC-3'$
Write down the sequence of complementary strand in $5^{\prime} \rightarrow 3^{\prime}$ direction
The $DNA$ strands are complementary to each other with respect to base sequence. Hence, if the sequence of one strand of $DNA$ is
$5'- ATGCATGCATGCATGCATGCATGCATGC - 3' $
Then, the sequence of complementary strand in $5 '$ to $3 '$ direction will be
$3'- TACGTACGTACGTACGTACGTACGTACG - 5' $
Therefore, the sequence of nucleotides on $DNA$ polypeptide in $5^{\prime}$ to $3^{\prime}$ direction is
$5'- GCATGCATGCATGCATGCATGCATGCAT-3'$
Similar Questions
Portion of gene which is transcribed but not translated is
When a mature $mRNA$ was hybridised to its gene certain loops were observed. These loops represent
When a mature $mRNA$ was hybridised to its gene certain loops were observed. These loops represent
The process by which $DNA$ of nucleus passes genetic information to $mRNA$
The process by which $DNA$ of nucleus passes genetic information to $mRNA$
- [AIIMS 1980]
Which enzyme plays important role in transcription
Which enzyme plays important role in transcription
Removal of $RNA$ polymerase $III$ from nucleoplasm will affect the synthesis of
Removal of $RNA$ polymerase $III$ from nucleoplasm will affect the synthesis of
- [AIPMT 2012]