If the sequence of one strand of $DNA$ is written as follows:

$5'- ATGCATGCATGCATGCATGCATGCATGC-3'$

Write down the sequence of complementary strand in $5^{\prime} \rightarrow 3^{\prime}$ direction

Vedclass pdf generator app on play store
Vedclass iOS app on app store

The $DNA$ strands are complementary to each other with respect to base sequence. Hence, if the sequence of one strand of $DNA$ is

$5'- ATGCATGCATGCATGCATGCATGCATGC - 3' $

Then, the sequence of complementary strand in $5 '$ to $3 '$ direction will be

$3'- TACGTACGTACGTACGTACGTACGTACG - 5' $

Therefore, the sequence of nucleotides on $DNA$ polypeptide in $5^{\prime}$ to $3^{\prime}$ direction is

$5'- GCATGCATGCATGCATGCATGCATGCAT-3'$

Similar Questions

Portion of gene which is transcribed but not translated is

When a mature $mRNA$ was hybridised to its gene certain loops were observed. These loops represent

The process by which $DNA$ of nucleus passes genetic information to $mRNA$

  • [AIIMS 1980]

Which enzyme plays important role in transcription

Removal of $RNA$ polymerase $III$ from nucleoplasm will affect the synthesis of

  • [AIPMT 2012]