Find out the correct statement about transcri | vedclass

Name: Exam Paper Generator | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

(A) $1$. In transcription,only one strand of the $dsDNA$ (double-stranded $DNA$) is copied into $RNA$ because if both strands were copied,they would p

Vedclass · Accepted Answer

In transcription,only one strand of $dsDNA$ is copied into $RNA$.

Vedclass · Answer

(A) $1$. In transcription,only one strand of the $dsDNA$ (double-stranded $DNA$) is copied into $RNA$ because if both strands were copied,they would produce two $RNA$ molecules with complementary sequences,which would form a double-stranded $RNA$ and prevent translation.$2$. Option $B$ is incorrect because eukaryotes use $RNA$ polymerases $(I, II, III)$,not $DNA$ polymerase,for transcription.$3$. Option $C$ is incorrect because in prokaryotes,there is no nucleus,so transcription and translation occur in the same compartment (cytoplasm).$4$. Option $D$ is incorrect because the primary transcript in eukaryotes contains both exons and introns (it is a pre-$mRNA$ that undergoes splicing to remove introns).Therefore,the correct statement is $A$.

Find out the correct statement about transcription $:-$

Similar Questions

Which molecule transfers genetic information from the nucleus to the ribosomes?

Which one of the following is the sequence on the corresponding coding strand,if the sequence on the mRNA formed is as follows $5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'$?

The removal of introns and joining of exons is known as.......

What is the role of $RNA$ polymerase $III$ in the process of transcription in eukaryotes?

Select the appropriate option for the coding sequence (expressed sequence).

Vedclass Test Series

Exam Paper Generator

Online Exam Module