Eukaryotic $RNA$ polymerase $III$ catalyse the synthesis of
$m\ RNA$
$t\ RNA$
$18.5\ rRNA$
Introns
The process by which $DNA$ of nucleus passes genetic information to $mRNA$
Genetic information transfer nucleus to cytoplasm by
Poly $A$ tail is present in
What role does messenger $RNA$ play in the synthesis of proteins?
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?