Eukaryotic $RNA$ polymerase $III$ catalyse the synthesis of

  • A

    $m\ RNA$

  • B

    $t\ RNA$

  • C

    $18.5\ rRNA$

  • D

    Introns

Similar Questions

The process by which $DNA$ of nucleus passes genetic information to $mRNA$

  • [AIIMS 1980]

Genetic information transfer nucleus to cytoplasm by

Poly $A$ tail is present in

What role does messenger $RNA$ play in the synthesis of proteins?

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?

  • [NEET 2023]