Depending upon the chemical nature of the template $(DNA$ or $RNA)$ and the nature of nucleic acids synthesised from it $(DNA$ or $RNA)$, list the types of nucleic acid polymerases.
There are two different types of nucleic acid polymerases
$DNA-$ dependent $DNA$ polymerases
$DNA-$ dependent $RNA$ polymerases
The $DNA-$ dependent $DNA$ polymerases use a $DNA$ template for synthesizing a new strand of $DNA$, whereas $DNA-$ dependent $RNA $ polymerases use a $DNA$ template strand for synthesizing $RNA$.
In the process of transcription in Eukaryotes, the $RNA$ polymerase $I$ transcribes
$m\, -$ $RNA$ is formed by
What role does messenger $RNA$ play in the synthesis of proteins?
The process by which $DNA$ of nucleus passes genetic information to $mRNA$
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?