The process of removing introns and joining e | vedclass

Name: Exam Paper Generator | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

(C) In eukaryotic cells,the primary transcript (pre-$mRNA$) contains both coding sequences (exons) and non-coding sequences (introns). To produce a fu

Vedclass · Accepted Answer

Splicing

Vedclass · Answer

(C) In eukaryotic cells,the primary transcript (pre-$mRNA$) contains both coding sequences (exons) and non-coding sequences (introns). To produce a functional $mRNA$ molecule,the non-coding introns must be removed and the coding exons must be joined together in a specific order. This process is known as $Splicing$. $Capping$ involves the addition of a methylguanosine triphosphate to the $5'$ end,while $Tailing$ involves the addition of poly-$A$ residues to the $3'$ end.

The process of removing introns and joining exons in a defined order from $RNA$ is known as.........

Similar Questions

During transcription,the site on $DNA$ where $RNA$ polymerase binds is called .......

During transcription,the holoenzyme $RNA$ polymerase binds to the $DNA$ strand. It forms a structure resembling a saddle at a specific site on the $DNA$. This sequence is called .....

Which one is the correct product of $DNA$ dependent $RNA$ polymerase for the given template strand?
$3'TACATGGCAAATATCCATTCA5'$

Transcription means synthesis of

In which direction is $m-RNA$ synthesized on a $DNA$ template?

Vedclass Test Series

Exam Paper Generator

Online Exam Module