When a mature $mRNA$ was hybridised to its gene certain loops were observed. These loops represent
Introns in $DNA$
Introns in $rRNA$
Exons in $tRNA$
Exons in $DNA$
Given below is the sequence of coding strand of $DNA$ in a transcription unit $\rm {AATGCAGCTATTAGG} - 5^{\prime}$ write the sequence of $(a)$ its complementary strand $(b)$ the $mRNA$
The vector for genetic code is called
Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?
$3$'$TACATGGCAAATATCCATTCA5'$
What is meant by sense strand
In capping .......... is added to the $5'$ end of hn $RNA$