When a mature $mRNA$ was hybridised to its gene certain loops were observed. These loops represent

  • A

    Introns in $DNA$

  • B

    Introns in $rRNA$

  • C

    Exons in $tRNA$

  • D

    Exons in $DNA$

Similar Questions

Given below is the sequence of coding strand of $DNA$ in a transcription unit $\rm {AATGCAGCTATTAGG} - 5^{\prime}$ write the sequence of $(a)$ its complementary strand $(b)$ the $mRNA$

The vector for genetic code is called

Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?

$3$'$TACATGGCAAATATCCATTCA5'$

  • [NEET 2024]

What is meant by sense strand

In capping .......... is added to the $5'$ end of hn $RNA$