Reverse transcriptase:
Reverse transcriptase:
- A
$Disintegrates\; host \;DNA$
- B
$Translates\; host \;DNA$
- C
$Transcribes\; viral\; RNA\; to\; DNA$
- D
$Polymerises\; host\;DNA$
Similar Questions
What initiation and termination factors are involved in transcription in Eukaryotes ?
What initiation and termination factors are involved in transcription in Eukaryotes ?
- [NEET 2019]
Which one of the following is not a part of a transcription unit in $DNA$ ?
Which one of the following is not a part of a transcription unit in $DNA$ ?
- [AIPMT 2012]
Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?
$3$'$TACATGGCAAATATCCATTCA5'$
Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?
$3$'$TACATGGCAAATATCCATTCA5'$
- [NEET 2024]
What are the functions of $(i)$ methylated guanasine cap, $(ii)$ poly $-A$ “tail” in a mature on $RNA $ ?
What are the functions of $(i)$ methylated guanasine cap, $(ii)$ poly $-A$ “tail” in a mature on $RNA $ ?
Definitions/Explanation : Exons & Introns
Definitions/Explanation : Capping & Tailing
Definitions/Explanation : Exons & Introns
Definitions/Explanation : Capping & Tailing