Identify $a, b$ and $c$
$(a)$ Elongation, $(b)$ Termination, $(c)$ Initiation
$(a)$ Initiation, $(b)$ Termination, $(c)$ Elongation
$(a)$ Initiation, $(b)$ Elongation, $(c)$ Termination
$(a)$ Termination, $(b)$ Elongation, $(c)$ Initiation
Removal of $RNA$ polymerase $III$ from nucleoplasm will affect the synthesis of
Which of the following statements about $RNA$ polymerase are correct?
$i. \;RNA\; polymerase \;I \;transcribes \;rRNAs$.
$ii. \;RNA \;polymerase \;II \;transcribes \;snRNAs.$
$iii. \;RNA \;polymerase \;III \;transcribes \;hnRNA.$
$iv. \;RNA \;polymerase \;II \;transcribes \;hnRNAs.$
Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?
$3$'$TACATGGCAAATATCCATTCA5'$
What role does messenger $RNA$ play in the synthesis of proteins?
If the $DNA$ strand has the nitrogenous base sequence $ATTGCC$, the $mRNA$ will have