Identify $a, b$ and $c$

982-657

  • [AIIMS 2019]
  • A

    $(a)$ Elongation, $(b)$ Termination, $(c)$ Initiation

  • B

    $(a)$ Initiation, $(b)$ Termination, $(c)$ Elongation

  • C

    $(a)$ Initiation, $(b)$ Elongation, $(c)$ Termination

  • D

    $(a)$ Termination, $(b)$ Elongation, $(c)$ Initiation

Similar Questions

Removal of $RNA$ polymerase $III$ from nucleoplasm will affect the synthesis of

  • [AIPMT 2012]

Which of the following statements about $RNA$ polymerase are correct?

$i. \;RNA\; polymerase \;I \;transcribes \;rRNAs$.

$ii. \;RNA \;polymerase \;II \;transcribes \;snRNAs.$

$iii. \;RNA \;polymerase \;III \;transcribes \;hnRNA.$

$iv. \;RNA \;polymerase \;II \;transcribes \;hnRNAs.$

Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?

$3$'$TACATGGCAAATATCCATTCA5'$

  • [NEET 2024]

What role does messenger $RNA$ play in the synthesis of proteins?

If the $DNA$ strand has the nitrogenous base sequence $ATTGCC$, the $mRNA$ will have