Identify a, b and c | vedclass

Name: PDF Generator App | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

The process of transcription occurs in three stages-initiation, elongation, followed by termination. The process occurs in the $5^{\prime}-3^{\prime}$

Vedclass · Accepted Answer

$(a)$ Initiation, $(b)$ Termination, $(c)$ Elongation

Vedclass · Answer

The process of transcription occurs in three stages-initiation, elongation, followed by termination. The process occurs in the $5^{\prime}-3^{\prime}$ direction. During initiation the complex of $RNA$ polymerase, sigma factor and promoter is present at the beginning. It reaches in the middle during elongation. Finally, the complex is released at the time of termination.

Identify $a, b$ and $c$

Similar Questions

Removal of $RNA$ polymerase $III$ from nucleoplasm will affect the synthesis of

Which of the following statements about $RNA$ polymerase are correct?

$i. \;RNA\; polymerase \;I \;transcribes \;rRNAs$.

$ii. \;RNA \;polymerase \;II \;transcribes \;snRNAs.$

$iii. \;RNA \;polymerase \;III \;transcribes \;hnRNA.$

$iv. \;RNA \;polymerase \;II \;transcribes \;hnRNAs.$

Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?

$3$'$TACATGGCAAATATCCATTCA5'$

What role does messenger $RNA$ play in the synthesis of proteins?

If the $DNA$ strand has the nitrogenous base sequence $ATTGCC$, the $mRNA$ will have