Identification and binding of $RNA$ polymerase to the promoter sequence is a function of
Identification and binding of $RNA$ polymerase to the promoter sequence is a function of
- A
Rho factor
- B
Sigma factor
- C
Beta factor
- D
Omega factor
Similar Questions
Reverse transcriptase:
Reverse transcriptase:
Formation of $RNA$ strand on template $DNA$ is
Formation of $RNA$ strand on template $DNA$ is
In protein synthesis, the polymerization of amino acids involves three steps. Which of the following is not involved in protein synthesis
In protein synthesis, the polymerization of amino acids involves three steps. Which of the following is not involved in protein synthesis
What is the role of $RNA$ polymerase $III$ in the process of transcription in eukaryotes?
What is the role of $RNA$ polymerase $III$ in the process of transcription in eukaryotes?
- [NEET 2021]
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?
- [NEET 2023]