Exon part of $m-RNAs$ has code for
Exon part of $m-RNAs$ has code for
- [AIPMT 2002]
- A
Protein
- B
Lipid
- C
Phospholipid
- D
Carbohydrate
Similar Questions
Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?
$3$'$TACATGGCAAATATCCATTCA5'$
Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?
$3$'$TACATGGCAAATATCCATTCA5'$
- [NEET 2024]
$DNA$ sequence that code for protein are knows as
$DNA$ sequence that code for protein are knows as
Choose the correct statement.
Choose the correct statement.
- [AIIMS 2019]
If there are $81\; million$ bases in $RNA$ of human cell, then calculate the total number of introns present in $cDNA$
If there are $81\; million$ bases in $RNA$ of human cell, then calculate the total number of introns present in $cDNA$