Definitions/Explanation : Gene &  Split gene
 

Vedclass pdf generator app on play store
Vedclass iOS app on app store

Gene is the functional unit of inheritance. The $DNA$ sequence coding for $rRNA$ or $tRNA$ molecule also define gene.

The gene with both exons and introns is a characteristic of eukaryotic $DNA$.

Similar Questions

Explain different types of $RNA$ and Explain the process of transcription.

Explain (in one or two lines) the function of the followings:

$(a)$ Promoter

$(b)$ $tRNA$

$(c)$ Exons

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?

  • [NEET 2023]

Which enzyme plays important role in transcription

Methyl guanosine triphosphate is added at $5 '$ end of hn-$RNA$ in a process of