Definitions/Explanation : Gene & Split gene
Definitions/Explanation : Gene & Split gene
Gene is the functional unit of inheritance. The $DNA$ sequence coding for $rRNA$ or $tRNA$ molecule also define gene.
The gene with both exons and introns is a characteristic of eukaryotic $DNA$.
Similar Questions
Explain different types of $RNA$ and Explain the process of transcription.
Explain different types of $RNA$ and Explain the process of transcription.
Explain (in one or two lines) the function of the followings:
$(a)$ Promoter
$(b)$ $tRNA$
$(c)$ Exons
Explain (in one or two lines) the function of the followings:
$(a)$ Promoter
$(b)$ $tRNA$
$(c)$ Exons
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?
- [NEET 2023]
Which enzyme plays important role in transcription
Which enzyme plays important role in transcription
Methyl guanosine triphosphate is added at $5 '$ end of hn-$RNA$ in a process of
Methyl guanosine triphosphate is added at $5 '$ end of hn-$RNA$ in a process of