Explain different types of $RNA$ and Explain the process of transcription.
Explain (in one or two lines) the function of the followings:
$(a)$ Promoter
$(b)$ $tRNA$
$(c)$ Exons
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?
Which enzyme plays important role in transcription
Methyl guanosine triphosphate is added at $5 '$ end of hn-$RNA$ in a process of