Write short note on Transcription unit.
A transcription unit in $DNA$ is defined primarily by the three regions in the $DNA$ : $(i)$ A promoter $(ii)$ The structural gene $(iii)$ A Terminator.
There is a convention in defining the two strands of the $DNA$ in the structural gene of a transcription unit.
Since the two strands have opposite polarity and the $DNA$ dependent $RNA$ polymerase also catalyse the polymerisation in only one direction that is $5^{\prime} \rightarrow 3^{\prime}$, the strand that has the polarity $3^{\prime} \rightarrow 5^{\prime}$ acts as a template and is also referred to as template strand.
The other strand which has the polarity $\left(5^{\prime} \rightarrow 3^{\prime}\right)$ and the sequence same as $RNA$ (except thymine at the place of uracil) is displaced during transcription.
Strangely, this strand (which does not code for anything) is referred to as coding strand.
All the reference point while defining a transcription unit is made with coding strand.
To explain the point, a hypothetical sequence from a transcription unit is represented below:
$3'$- $ATGCATGCATGCATGCATGCATGC$ - $5'$ Template Strand
$5'$ - $TACGTACGTACGTACGTACGTACG$ - $3 '$ Coding Strand
$(i)$ A promoter is $DNA$ sequence that provides binding, site for $RNA$, polymerase.
It is located at $5^{\prime}$ end (upstream) of the structural gene. (the reference is made with respect to the polarity of coding strand).
It is a $DNA$ sequence that provides binding site for $RNA$ polymerase and it is the presence of the promoter in a transcription unit that also defines the template and coding strands.
By switching its position with terminator the definition of coding and template strands could be reversed.
The terminator is located towards $3^{\prime}$ - end (downstream) of the coding strand and it usually defines the end of the process of transcription.
There are additional regulatory sequences that may me present further upstream or downstream to promoter.
$(ii)$ The structural gene in a transcription unit is flanked by the promoter and terminator.
$(iii)$ A terminator is located towards the $3^{\prime}$ and (downstream) of the coding strand.
It usually defines the end of transcription process.
In tailing, adenylate residues are added at $3'$ end
Transcription is a process by which
Choose the correct statement.
Genetic information transfer nucleus to cytoplasm by
Which of the following is nongenetic, which is utilised for protein synthesis