Write a explanatory note on Transcription unit and the gene.
 

Vedclass pdf generator app on play store
Vedclass iOS app on app store

A gene is defined as the functional unit of inheritance. Though there is no ambiguity that the genes are located on the $DNA$ , it is difficult to literally define a gene in terms of $DNA$ sequence.

The $DNA$ sequence coding for $tRNA$ or $rRNA$ molecule also define a gene. However by defining a cistron as a segment of $DNA$ coding for a polypeptide, the structural gene in a transcription unit could be said as monocistronic (mostly in eukaryotes) or polycistronic (mostly in bacteria or prokaryotes).

In eukaryotes, the monocistronic structural genes have interrupted coding sequences -the genes in eukaryotes are split. The coding sequences or expressed sequences are defined as exons. Exons are said to be those sequence that appear in mature or processed $RNA$. The exons are interrupted by introns. Introns or intervening sequences do not appear in mature or processed $RNA$. The split-gene arrangement further complicates the definition of a gene in terms of a $DNA$ segment.
          Inheritance of a character is also affected by promoter and regulatory sequences of a structural gene. Hence, sometime the regulatory sequences are loosely defined as regulatory genes, even though these sequences do not code for any $RNA$ or protein.

Similar Questions

In eukaryotes $mRNA$ transcribed is called

Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?

$3$'$TACATGGCAAATATCCATTCA5'$

  • [NEET 2024]

Eukaryotic $RNA$ polymerase $III$ catalyse the synthesis of

Transcription

Synthesis of $m - RNA$ is